Corrigendum to ‘Assessment of a quantitative 5′ nuclease real-time polymerase chain reaction using groEL gene for Ehrlichia and Anaplasma species in rodents in Brazil’ [Ticks and Tick-Borne Diseases 8 (2017) 646–656/4, (S1877959X1730033X), (10.1016/j.ttbdis.2017.04.011)]

Jyan Lucas Benevenute; John Stephen Dumler; Maria Ogrzewalska; André Luiz Rodrigues Roque; Victoria Valente Califre Mello; Keyla Carstens Marques de Sousa; Luiz Ricardo Gonçalves; Paulo Sérgio D'Andrea; Elba Regina de Sampaio Lemos; Rosangela Zacarias Machado; Marcos Rogério André

doi:10.1016/j.ttbdis.2023.102245

Corrigendum to ‘Assessment of a quantitative 5′ nuclease real-time polymerase chain reaction using groEL gene for Ehrlichia and Anaplasma species in rodents in Brazil’ [Ticks and Tick-Borne Diseases 8 (2017) 646–656/4, (S1877959X1730033X), (10.1016/j.ttbdis.2017.04.011)]

Jyan Lucas Benevenute, John Stephen Dumler, Maria Ogrzewalska, André Luiz Rodrigues Roque, Victoria Valente Califre Mello, Keyla Carstens Marques de Sousa, Luiz Ricardo Gonçalves, Paulo Sérgio D'Andrea, Elba Regina de Sampaio Lemos, Rosangela Zacarias Machado, Marcos Rogério André^*

^*Corresponding author for this work

Pathology

Research output: Contribution to journal › Comment/debate

1 Scopus citations

Abstract

The authors regret <The sequences of primers and hydrolysis probes obtained using AlleleID6 were F-Ehr (5′- TTATCGTTACATTGAGAAGC - 3′), R-Ehr (5′- GATATAAAGTTATTAAAAGTATAAAGC -3′) and TET-5′-CATTGGCTCTTGCTATTGCTAAT -3′[BHQ2a-Q], and F-Anap (5′- GCGAGCATAATTACTCAGAG-3′), R-Anap (5′- CAGTATGGAGCATGTAGTAG -3′) and Cy5- 5′- CCACCTTATCATTACACTGAGACG -3′[BHQ2a-Q] for Ehrlichia and Anaplasma species, respectively.>. The authors would like to apologise for any inconvenience caused.

Original language	English
Article number	102245
Journal	Ticks and Tick-borne Diseases
Volume	14
Issue number	6
DOIs	https://doi.org/10.1016/j.ttbdis.2023.102245
State	Published - Nov 2023

Access to Document

10.1016/j.ttbdis.2023.102245

Cite this

Benevenute, J. L., Dumler, J. S., Ogrzewalska, M., Roque, A. L. R., Mello, V. V. C., de Sousa, K. C. M., Gonçalves, L. R., D'Andrea, P. S., Lemos, E. R. D. S., Machado, R. Z., & André, M. R. (2023). Corrigendum to ‘Assessment of a quantitative 5′ nuclease real-time polymerase chain reaction using groEL gene for Ehrlichia and Anaplasma species in rodents in Brazil’ [Ticks and Tick-Borne Diseases 8 (2017) 646–656/4, (S1877959X1730033X), (10.1016/j.ttbdis.2017.04.011)]. Ticks and Tick-borne Diseases, 14(6), Article 102245. https://doi.org/10.1016/j.ttbdis.2023.102245

Benevenute, Jyan Lucas ; Dumler, John Stephen ; Ogrzewalska, Maria et al. / Corrigendum to ‘Assessment of a quantitative 5′ nuclease real-time polymerase chain reaction using groEL gene for Ehrlichia and Anaplasma species in rodents in Brazil’ [Ticks and Tick-Borne Diseases 8 (2017) 646–656/4, (S1877959X1730033X), (10.1016/j.ttbdis.2017.04.011)]. In: Ticks and Tick-borne Diseases. 2023 ; Vol. 14, No. 6.

@article{b4ffd8ade13949bdaf543a07eb029f15,

title = "Corrigendum to {\textquoteleft}Assessment of a quantitative 5′ nuclease real-time polymerase chain reaction using groEL gene for Ehrlichia and Anaplasma species in rodents in Brazil{\textquoteright} [Ticks and Tick-Borne Diseases 8 (2017) 646–656/4, (S1877959X1730033X), (10.1016/j.ttbdis.2017.04.011)]",

abstract = "The authors regret <The sequences of primers and hydrolysis probes obtained using AlleleID6 were F-Ehr (5′- TTATCGTTACATTGAGAAGC - 3′), R-Ehr (5′- GATATAAAGTTATTAAAAGTATAAAGC -3′) and TET-5′-CATTGGCTCTTGCTATTGCTAAT -3′[BHQ2a-Q], and F-Anap (5′- GCGAGCATAATTACTCAGAG-3′), R-Anap (5′- CAGTATGGAGCATGTAGTAG -3′) and Cy5- 5′- CCACCTTATCATTACACTGAGACG -3′[BHQ2a-Q] for Ehrlichia and Anaplasma species, respectively.>. The authors would like to apologise for any inconvenience caused.",

author = "Benevenute, {Jyan Lucas} and Dumler, {John Stephen} and Maria Ogrzewalska and Roque, {Andr{\'e} Luiz Rodrigues} and Mello, {Victoria Valente Califre} and {de Sousa}, {Keyla Carstens Marques} and Gon{\c c}alves, {Luiz Ricardo} and D'Andrea, {Paulo S{\'e}rgio} and Lemos, {Elba Regina de Sampaio} and Machado, {Rosangela Zacarias} and Andr{\'e}, {Marcos Rog{\'e}rio}",

note = "Publisher Copyright: {\textcopyright} 2023 Elsevier GmbH",

year = "2023",

month = nov,

doi = "10.1016/j.ttbdis.2023.102245",

language = "English",

volume = "14",

journal = "Ticks and Tick-borne Diseases",

issn = "1877-959X",

publisher = "Elsevier GmbH",

number = "6",

}

Benevenute, JL, Dumler, JS, Ogrzewalska, M, Roque, ALR, Mello, VVC, de Sousa, KCM, Gonçalves, LR, D'Andrea, PS, Lemos, ERDS, Machado, RZ & André, MR 2023, 'Corrigendum to ‘Assessment of a quantitative 5′ nuclease real-time polymerase chain reaction using groEL gene for Ehrlichia and Anaplasma species in rodents in Brazil’ [Ticks and Tick-Borne Diseases 8 (2017) 646–656/4, (S1877959X1730033X), (10.1016/j.ttbdis.2017.04.011)]', Ticks and Tick-borne Diseases, vol. 14, no. 6, 102245. https://doi.org/10.1016/j.ttbdis.2023.102245

Corrigendum to ‘Assessment of a quantitative 5′ nuclease real-time polymerase chain reaction using groEL gene for Ehrlichia and Anaplasma species in rodents in Brazil’ [Ticks and Tick-Borne Diseases 8 (2017) 646–656/4, (S1877959X1730033X), (10.1016/j.ttbdis.2017.04.011)]. / Benevenute, Jyan Lucas; Dumler, John Stephen; Ogrzewalska, Maria et al.
In: Ticks and Tick-borne Diseases, Vol. 14, No. 6, 102245, 11.2023.

Research output: Contribution to journal › Comment/debate

TY - JOUR

T1 - Corrigendum to ‘Assessment of a quantitative 5′ nuclease real-time polymerase chain reaction using groEL gene for Ehrlichia and Anaplasma species in rodents in Brazil’ [Ticks and Tick-Borne Diseases 8 (2017) 646–656/4, (S1877959X1730033X), (10.1016/j.ttbdis.2017.04.011)]

AU - Benevenute, Jyan Lucas

AU - Dumler, John Stephen

AU - Ogrzewalska, Maria

AU - Roque, André Luiz Rodrigues

AU - Mello, Victoria Valente Califre

AU - de Sousa, Keyla Carstens Marques

AU - Gonçalves, Luiz Ricardo

AU - D'Andrea, Paulo Sérgio

AU - Lemos, Elba Regina de Sampaio

AU - Machado, Rosangela Zacarias

AU - André, Marcos Rogério

PY - 2023/11

Y1 - 2023/11

N2 - The authors regret <The sequences of primers and hydrolysis probes obtained using AlleleID6 were F-Ehr (5′- TTATCGTTACATTGAGAAGC - 3′), R-Ehr (5′- GATATAAAGTTATTAAAAGTATAAAGC -3′) and TET-5′-CATTGGCTCTTGCTATTGCTAAT -3′[BHQ2a-Q], and F-Anap (5′- GCGAGCATAATTACTCAGAG-3′), R-Anap (5′- CAGTATGGAGCATGTAGTAG -3′) and Cy5- 5′- CCACCTTATCATTACACTGAGACG -3′[BHQ2a-Q] for Ehrlichia and Anaplasma species, respectively.>. The authors would like to apologise for any inconvenience caused.

AB - The authors regret <The sequences of primers and hydrolysis probes obtained using AlleleID6 were F-Ehr (5′- TTATCGTTACATTGAGAAGC - 3′), R-Ehr (5′- GATATAAAGTTATTAAAAGTATAAAGC -3′) and TET-5′-CATTGGCTCTTGCTATTGCTAAT -3′[BHQ2a-Q], and F-Anap (5′- GCGAGCATAATTACTCAGAG-3′), R-Anap (5′- CAGTATGGAGCATGTAGTAG -3′) and Cy5- 5′- CCACCTTATCATTACACTGAGACG -3′[BHQ2a-Q] for Ehrlichia and Anaplasma species, respectively.>. The authors would like to apologise for any inconvenience caused.

UR - http://www.scopus.com/inward/record.url?scp=85169540295&partnerID=8YFLogxK

U2 - 10.1016/j.ttbdis.2023.102245

DO - 10.1016/j.ttbdis.2023.102245

M3 - Comment/debate

C2 - 37657953

AN - SCOPUS:85169540295

SN - 1877-959X

VL - 14

JO - Ticks and Tick-borne Diseases

JF - Ticks and Tick-borne Diseases

IS - 6

M1 - 102245

ER -

Benevenute JL, Dumler JS, Ogrzewalska M, Roque ALR, Mello VVC, de Sousa KCM et al. Corrigendum to ‘Assessment of a quantitative 5′ nuclease real-time polymerase chain reaction using groEL gene for Ehrlichia and Anaplasma species in rodents in Brazil’ [Ticks and Tick-Borne Diseases 8 (2017) 646–656/4, (S1877959X1730033X), (10.1016/j.ttbdis.2017.04.011)]. Ticks and Tick-borne Diseases. 2023 Nov;14(6):102245. doi: 10.1016/j.ttbdis.2023.102245